Top » Catalog » SNPs » BZ3279

$18.00

BZ3279
[BZ3279]

BZ3279
hg38 Position: ChrY:16107064..16107064
Ancestral: T
Derived: C
Reference: Vladimir Gurianov (2017)
ISOGG Haplogroup: Q
Comments: Within DYS620
Forward Primer: BZ3279_F TTTATGCTATTATGTGTGTGGTAACAGA
Reverse Primer: BZ3279_R CCAAATCTTGCTACCATACAGATTTAC
Reviews

Customers who bought this product also purchased
Z21133
Z21133
Z17274
Z17274
DYS460
DYS460
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies