Top » Catalog » SNPs » BZ3279

$18.00

BZ3279
[BZ3279]

BZ3279
hg38 Position: ChrY:16107064..16107064
Ancestral: T
Derived: C
Reference: Vladimir Gurianov (2017)
ISOGG Haplogroup: Q
Comments: Within DYS620
Forward Primer: BZ3279_F TTTATGCTATTATGTGTGTGGTAACAGA
Reverse Primer: BZ3279_R CCAAATCTTGCTACCATACAGATTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies