Top » Catalog » SNPs » A7022

$18.00

A7022
[A7022]

A7022
hg38 Position: ChrY:8996070..8996070
Ancestral: C
Derived: T
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7022_F CAAAGTCTAATTCAAAGACATATACACAGG
Reverse Primer: A7022_R AGGCACAGTAGGAGGAACTGTC
Reviews

Customers who bought this product also purchased
R1a-YP1078 Segregation Panel
R1a-YP1078 Segregation Panel
A7019
A7019
A7025
A7025
A7018
A7018
A7024
A7024
A7017
A7017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies