Top » Catalog » SNPs » FGC17112

$18.00

FGC17112
[FGC17112]

FGC17112
hg38 Position: ChrY:13281955..13281955
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > Z42772
Forward Primer: FGC17112_F GCTTTCAGCGTAGGGCAAG
Reverse Primer: FGC17112_R TTTATTGGCCTTCTGTCCATTC
Reviews

Customers who bought this product also purchased
BY96801
BY96801
BY27833
BY27833
Y138237
Y138237
L238
L238
FGC17114
FGC17114
M343
M343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies