Top » Catalog » SNPs » FGC17112

$18.00

FGC17112
[FGC17112]

FGC17112
hg38 Position: ChrY:13281955..13281955
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > Z42772
Forward Primer: FGC17112_F GCTTTCAGCGTAGGGCAAG
Reverse Primer: FGC17112_R TTTATTGGCCTTCTGTCCATTC
Reviews

Customers who bought this product also purchased
BY27833
BY27833
Y138237
Y138237
L238
L238
BY96801
BY96801
FGC17114
FGC17114
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies