Top » Catalog » SNPs » YP4295

$18.00

YP4295
[YP4295]

YP4295
hg38 Position: ChrY:2927911..2927911
Ancestral: G
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of DF27
Forward Primer: YP4295_F AGTGATTCTCCTGCCTCAGG
Reverse Primer: YP4295_R GTGGATCGTGAAATAGGTGAAAG
Reviews

Customers who bought this product also purchased
FT44481
FT44481
Y139205
Y139205
BY186642
BY186642
PH2054
PH2054
S2292
S2292
Y134946
Y134946
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies