Top » Catalog » SNPs » YP4295

$18.00

YP4295
[YP4295]

YP4295
hg38 Position: ChrY:2927911..2927911
Ancestral: G
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of DF27
Forward Primer: YP4295_F AGTGATTCTCCTGCCTCAGG
Reverse Primer: YP4295_R GTGGATCGTGAAATAGGTGAAAG
Reviews

Customers who bought this product also purchased
FGC40704
FGC40704
BY96801
BY96801
BY27833
BY27833
Y138237
Y138237
L238
L238
FGC17114
FGC17114
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies