Top » Catalog » SNPs » FGC7393

$18.00

FGC7393
[FGC7393]

FGC7393
hg38 Position: ChrY:21428006..21428006
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a (not listed)
Comments: Below L222.2 > FGC5 > FGC1
Forward Primer: FGC7393v2_F CACACAAACACACACATTGTCC
Reverse Primer: FGC7393v2_R TAGTTCTGGTCCCCTGTTGC
Reviews

Customers who bought this product also purchased
HU397
HU397
FGC54413
FGC54413
ZS10287
ZS10287
FGC1696
FGC1696
FGC43128
FGC43128
ZS10488
ZS10488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies