Top » Catalog » SNPs » FGC7393

$18.00

FGC7393
[FGC7393]

FGC7393
hg38 Position: ChrY:21428006..21428006
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a (not listed)
Comments: Below L222.2 > FGC5 > FGC1
Forward Primer: FGC7393v2_F CACACAAACACACACATTGTCC
Reverse Primer: FGC7393v2_R TAGTTCTGGTCCCCTGTTGC
Reviews

Customers who bought this product also purchased
ZS11519
ZS11519
FGC44917
FGC44917
FGC44938
FGC44938
FGC4280
FGC4280
FGC44943
FGC44943
FGC48136
FGC48136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies