Top » Catalog » SNPs » FGC7393

$18.00

FGC7393
[FGC7393]

FGC7393
hg38 Position: ChrY:21428006..21428006
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a (not listed)
Comments: Below L222.2 > FGC5 > FGC1
Forward Primer: FGC7393v2_F CACACAAACACACACATTGTCC
Reverse Primer: FGC7393v2_R TAGTTCTGGTCCCCTGTTGC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
FGC43127
FGC43127
HU397
HU397
ZS10287
ZS10287
FGC1696
FGC1696
FGC43128
FGC43128
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies