Top » Catalog » SNPs » FGC7393

$18.00

FGC7393
[FGC7393]

FGC7393
hg38 Position: ChrY:21428006..21428006
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a (not listed)
Comments: Below L222.2 > FGC5 > FGC1
Forward Primer: FGC7393v2_F CACACAAACACACACATTGTCC
Reverse Primer: FGC7393v2_R TAGTTCTGGTCCCCTGTTGC
Reviews

Customers who bought this product also purchased
BY145
BY145
FT362659
FT362659
FGC57150
FGC57150
Y20902
Y20902
ZS10633
ZS10633
ZS3290
ZS3290
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies