Top » Catalog » SNPs » FGC7393

$19.00

FGC7393
[FGC7393]

FGC7393
hg38 Position: ChrY:21428006..21428006
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a (not listed)
Comments: Below L222.2 > FGC5 > FGC1
Forward Primer: FGC7393v2_F CACACAAACACACACATTGTCC
Reverse Primer: FGC7393v2_R TAGTTCTGGTCCCCTGTTGC
Reviews

Customers who bought this product also purchased
Y12883
Y12883
PF4664
PF4664
ZS5631
ZS5631
Y12364
Y12364
Y212448
Y212448
FGC57151
FGC57151
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies