Top » Catalog » SNPs » A7026

$18.00

A7026
[A7026]

A7026
hg38 Position: ChrY:2850553..2850553
Ancestral: A
Derived: G
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7026_F ATGGTGCTGTTGCTATCCATG
Reverse Primer: A7026_R CCTCTGTCCCTGATAACCAGAG
Reviews

Customers who bought this product also purchased
A7040
A7040
A7027
A7027
A7045
A7045
A7033
A7033
A7050
A7050
A7039
A7039
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies