Top » Catalog » SNPs » Z7958

$18.00

Z7958
[Z7958]

Z7958
hg38 Position: ChrY:8875652..8875652
Ancestral: A
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: G2a1a1a
Comments: Found in a G-L293 person
Forward Primer: Z7958_F ACCCAGGATGTGACAAGTGG
Reverse Primer: Z7958_R GAGGTTATTGGATCGGTTTCC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Z6679
Z6679
Z6692
Z6692
Z31461
Z31461
FGC715
FGC715
Z7940
Z7940
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies