Top » Catalog » SNPs » Z7958

$18.00

Z7958
[Z7958]

Z7958
HG19 Position: ChrY:8875652..8875652
Ancestral: A
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: G2a1a1a
Comments: Found in a G-L293 person
Forward Primer: Z7958_F ACCCAGGATGTGACAAGTGG
Reverse Primer: Z7958_R GAGGTTATTGGATCGGTTTCC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Z6679
Z6679
Z6692
Z6692
Z7940
Z7940
G2a-Z6552 Panel
G2a-Z6552 Panel
Z31459
Z31459
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies