Top » Catalog » SNPs » A7033

$18.00

A7033
[A7033]

A7033
hg38 Position: ChrY:12890904..12890905
Ancestral: del
Derived: ins
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7033_F TAGGCAAATGCAGGAAAATG
Reverse Primer: A7033_R TTTTGGTAATTGCCCTCTGC
Reviews

Customers who bought this product also purchased
A7043
A7043
A7029
A7029
A7048
A7048
A7037
A7037
A7042
A7042
A7028
A7028
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies