Top » Catalog » SNPs » A7035

$18.00

A7035
[A7035]

A7035
hg38 Position: ChrY:13347033..13347034
Ancestral: del
Derived: ins
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7035_F CAGAAGCCAACGGTACACAG
Reverse Primer: A7035_R GACCCTGAAGCTGTGCTAGG
Reviews

Customers who bought this product also purchased
A7033
A7033
A7051
A7051
A7040
A7040
A7026
A7026
A7045
A7045
A7032
A7032
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies