Top » Catalog » SNPs » A7035

$18.00

A7035
[A7035]

A7035
hg38 Position: ChrY:13347033..13347034
Ancestral: del
Derived: ins
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7035_F CAGAAGCCAACGGTACACAG
Reverse Primer: A7035_R GACCCTGAAGCTGTGCTAGG
Reviews

Customers who bought this product also purchased
A7039
A7039
R1b-Z2185 HEAVEY Family Segregation Panel
R1b-Z2185 HEAVEY Family Segregation Panel
A7044
A7044
A7030
A7030
A7049
A7049
A7038
A7038
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies