Top » Catalog » SNPs » A7036

$18.00

A7036
[A7036]

A7036
hg38 Position: ChrY:14290874..14290874
Ancestral: G
Derived: T
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7036_F ATGTGACACATTATGATGTAAAATATGAGAG
Reverse Primer: A7036_R GTAACCTACCAAAAATGTTCTCTTCA
Reviews

Customers who bought this product also purchased
A7041
A7041
A7027
A7027
A7046
A7046
A7033
A7033
A7051
A7051
A7040
A7040
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies