Top » Catalog » SNPs » A7037

$18.00

A7037
[A7037]

A7037
hg38 Position: ChrY:15253659..15253660
Ancestral: del
Derived: ins
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7037_F ATCATGGTGCCATGCATTAG
Reverse Primer: A7037_R ACAGCCCTCTTCTCATTTGC
Reviews

Customers who bought this product also purchased
A7032
A7032
A7050
A7050
A7039
A7039
R1b-Z2185 HEAVEY Family Segregation Panel
R1b-Z2185 HEAVEY Family Segregation Panel
A7044
A7044
A7030
A7030
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies