Top » Catalog » SNPs » Z6049

$18.00

Z6049
[Z6049]

Z6049
hg38 Position: ChrY:13671304..13671304
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: J2 (not listed)
Comments: Approx. hg: J-M410
Forward Primer: Z6049_F AGAAACCCTGGAAGGTCCTC
Reverse Primer: Z6049_R CTCATCCAGGAGGCACAGAG
Reviews

Customers who bought this product also purchased
Y8531
Y8531
Y14678
Y14678
M9
M9
Y7708
Y7708
Y29011
Y29011
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies