Top » Catalog » SNPs » Z6049

$18.00

Z6049
[Z6049]

Z6049
hg38 Position: ChrY:13671304..13671304
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: J2 (not listed)
Comments: Approx. hg: J-M410
Forward Primer: Z6049_F AGAAACCCTGGAAGGTCCTC
Reverse Primer: Z6049_R CTCATCCAGGAGGCACAGAG
Reviews

Customers who bought this product also purchased
M168
M168
L24
L24
M96
M96
PF5125
PF5125
Y84796
Y84796
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies