Top » Catalog » SNPs » A7045

$18.00

A7045
[A7045]

A7045
hg38 Position: ChrY:19762955..19762955
Ancestral: G
Derived: C
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7045_F ACAGTGGCAGCACACTATGG
Reverse Primer: A7045_R CCCCATTTGCTGGTGTATG
Reviews

Customers who bought this product also purchased
A7029
A7029
A7048
A7048
A7036
A7036
A7041
A7041
A7028
A7028
A7047
A7047
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies