Top » Catalog » SNPs » A7047

$18.00

A7047
[A7047]

A7047
hg38 Position: ChrY:19883380..19883380
Ancestral: C
Derived: T
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7047_F TGACAAGCCACACCATTTTC
Reverse Primer: A7047_R GTTTGTAGGGCATGGCTCTC
Reviews

Customers who bought this product also purchased
A7038
A7038
R1b-Z2185 HEAVEY Family Segregation Panel
R1b-Z2185 HEAVEY Family Segregation Panel
A7043
A7043
A7030
A7030
A7049
A7049
A7037
A7037
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies