Top » Catalog » SNPs » A7048

$18.00

A7048
[A7048]

A7048
hg38 Position: ChrY:20635323..20635323
Ancestral: C
Derived: T
Reference: Col John D Heavey (2015)
ISOGG Haplogroup: R1b1a2a1a2c1f
Comments: Downstream Z253 > Z2534 > Z2185
Forward Primer: A7048_F TCATTAGTGTGTGGTTTTGGTTG
Reverse Primer: A7048_R GCCTGGATGACATTGGAGAC
Reviews

Customers who bought this product also purchased
A7030
A7030
A7049
A7049
A7037
A7037
A7042
A7042
A7029
A7029
A7047
A7047
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies