Top » Catalog » SNPs » A196

$18.00

A196
[A196]

A196
hg38 Position: ChrY:15141469..15141469
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I1a2a1a3
Comments: Downstream I1-Z140
Forward Primer: A196_F TCAGGGATTTTTAGCCAACAG
Reverse Primer: A196_R TAGTGATCCCATTGGGGTTG
Reviews

Customers who bought this product also purchased
FGC65549
FGC65549
CTS6739
CTS6739
BY178134
BY178134
YP1084
YP1084
CTS11603
CTS11603
Y7477
Y7477
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies