Top » Catalog » SNPs » A196

$18.00

A196
[A196]

A196
hg38 Position: ChrY:15141469..15141469
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I1a2a1a3
Comments: Downstream I1-Z140
Forward Primer: A196_F TCAGGGATTTTTAGCCAACAG
Reverse Primer: A196_R TAGTGATCCCATTGGGGTTG
Reviews

Customers who bought this product also purchased
BY178134
BY178134
FGC65549
FGC65549
CTS6739
CTS6739
Y23688
Y23688
A16378
A16378
FGC41265
FGC41265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies