Top » Catalog » SNPs » A292

$18.00

A292
[A292]

A292
hg38 Position: ChrY:14289054..14289054
Ancestral: A
Derived: G
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: .
Forward Primer: A292_F CTCATAAAGCCACATGATGGG
Reverse Primer: A292_R GAAACAACTTCCTAGATATATCACTGAATC
Reviews

Customers who bought this product also purchased
A214
A214
A351
A351
A337
A337
A346
A346
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A212
A212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies