Top » Catalog » SNPs » A28052

$18.00

A28052
[A28052]

A28052
hg38 Position: ChrY:20531137..20531137
Ancestral: C
Derived: T
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A28052_F GTAAAAGAACAGAAATTGTCAGAAACC
Reverse Primer: A28052_R GAGAGGGTGTATGTTTTGAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies