Top » Catalog » SNPs » Z23507

$18.00

Z23507
[Z23507]

Z23507
hg38 Position: ChrY:7181418..7181418
Ancestral: G
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b (not listed)
Comments: Downstream of R-L21>DF13>L513
Forward Primer: Z23507_F AACCTACTGGGGCATTTCAAC
Reverse Primer: Z23507_R GGAAATAATATTGAAGCAAGCTGTC
Reviews

Customers who bought this product also purchased
A3
A3
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies