Top » Catalog » SNPs » Z372

$18.00

Z372
[Z372]

Z372
hg38 Position: ChrY:19876329..19876329
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a1b1a
Comments: downstream of R-U106. upstream of L257;downstream of Z14. Z16-Z19
Forward Primer: Z372_F ATTAACCCCCAAAATCAAATAGC
Reverse Primer: Z372_R CTCTTCTCATGCCACAATTTACTC
Reviews

Customers who bought this product also purchased
ZP156
ZP156
S7047
S7047
FGC5797
FGC5797
S8402
S8402
DF95
DF95
BY114278
BY114278
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies