Top » Catalog » SNPs » Y9074

$18.00

Y9074
[Y9074]

Y9074
hg38 Position: ChrY:13001019..13001019
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: R1a-S7759
Comments: .
Forward Primer: Y9074_F TGGTCTCCAGACTATTTATTGAGTACAG
Reverse Primer: Y9074_R CAATAACCCTGATGAGCATAGATG
Reviews

Customers who bought this product also purchased
Y9077
Y9077
YP1189
YP1189
Y9076
Y9076
YP1188
YP1188
YP1194
YP1194
Y9075
Y9075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies