Top » Catalog » SNPs » Y9074

$18.00

Y9074
[Y9074]

Y9074
hg38 Position: ChrY:13001019..13001019
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: R1a-S7759
Comments: .
Forward Primer: Y9074_F TGGTCTCCAGACTATTTATTGAGTACAG
Reverse Primer: Y9074_R CAATAACCCTGATGAGCATAGATG
Reviews

Customers who bought this product also purchased
R1a-Y9073 Mortzell panel
R1a-Y9073 Mortzell panel
Y9079
Y9079
YP1191
YP1191
Y9078
Y9078
YP1190
YP1190
Y9077
Y9077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies