Top » Catalog » SNPs » Y9077

$18.00

Y9077
[Y9077]

Y9077
hg38 Position: ChrY:16582061..16582061
Ancestral: T
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1a-S7759
Comments: .
Forward Primer: Y9077_F TATTATATATAATATGCATGGATACAACAATATG
Reverse Primer: Y9077_R GCTTTGATTTGAAGACTTGCTGTC
Reviews

Customers who bought this product also purchased
YP1188
YP1188
YP1194
YP1194
Y9074
Y9074
YP1186
YP1186
YP1193
YP1193
R1a-Y9073 Mortzell panel
R1a-Y9073 Mortzell panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies