Top » Catalog » SNPs » Y9078

$18.00

Y9078
[Y9078]

Y9078
hg38 Position: ChrY:17079852..17079852
Ancestral: G
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: R1a-S7759
Comments: .
Forward Primer: Y9078_F CTGCCTCAGGAGAGTAACAGG
Reverse Primer: Y9078_R TGGTTTCTCTCACGTGCAAC
Reviews

Customers who bought this product also purchased
YP1194
YP1194
Y9074
Y9074
YP1186
YP1186
YP1193
YP1193
R1a-Y9073 Mortzell panel
R1a-Y9073 Mortzell panel
Y9079
Y9079
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4440
$18.00
Haplogroup Info
Other products
Currencies