Top » Catalog » SNPs » Y9078

$18.00

Y9078
[Y9078]

Y9078
hg38 Position: ChrY:17079852..17079852
Ancestral: G
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: R1a-S7759
Comments: .
Forward Primer: Y9078_F CTGCCTCAGGAGAGTAACAGG
Reverse Primer: Y9078_R TGGTTTCTCTCACGTGCAAC
Reviews

Customers who bought this product also purchased
YP1189
YP1189
Y9075
Y9075
YP1188
YP1188
YP1194
YP1194
Y9074
Y9074
YP1186
YP1186
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies