Top » Catalog » SNPs » YP1186

$18.00

YP1186
[YP1186]

YP1186
hg38 Position: ChrY:8899043..8899043
Ancestral: T
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Y9073
Forward Primer: YP1186_F GATGCAAATGTGGTACACCG
Reverse Primer: YP1186_R GGATAATAAAAGATGTATTCAGAAGGAAG
Reviews

Customers who bought this product also purchased
Y9075
Y9075
YP1188
YP1188
YP1194
YP1194
Y9074
Y9074
Y9079
Y9079
YP1193
YP1193
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies