Top » Catalog » SNPs » YP1186

$18.00

YP1186
[YP1186]

YP1186
hg38 Position: ChrY:8899043..8899043
Ancestral: T
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Y9073
Forward Primer: YP1186_F GATGCAAATGTGGTACACCG
Reverse Primer: YP1186_R GGATAATAAAAGATGTATTCAGAAGGAAG
Reviews

Customers who bought this product also purchased
Y9078
Y9078
YP1191
YP1191
Y9077
Y9077
YP1190
YP1190
Y9076
Y9076
YP1189
YP1189
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies