Top » Catalog » SNPs » YP1186

$18.00

YP1186
[YP1186]

YP1186
hg38 Position: ChrY:8899043..8899043
Ancestral: T
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Y9073
Forward Primer: YP1186_F GATGCAAATGTGGTACACCG
Reverse Primer: YP1186_R GGATAATAAAAGATGTATTCAGAAGGAAG
Reviews

Customers who bought this product also purchased
Y9079
Y9079
YP1193
YP1193
R1a-Y9073 Mortzell panel
R1a-Y9073 Mortzell panel
Y9078
Y9078
YP1191
YP1191
Y9077
Y9077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies