Top » Catalog » SNPs » YP1189

$18.00

YP1189
[YP1189]

YP1189
hg38 Position: ChrY:15951113..15951113
Ancestral: G
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Downstream Y9073
Forward Primer: YP1189_F TCAACGCAAAAATGGATGAG
Reverse Primer: YP1189_R GGGTGAGTAAGGTGGTCAGG
Reviews

Customers who bought this product also purchased
Y9076
Y9076
YP1188
YP1188
Y9075
Y9075
YP1186
YP1186
YP1194
YP1194
Y9074
Y9074
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies