Top » Catalog » SNPs » YP1191

$18.00

YP1191
[YP1191]

YP1191
hg38 Position: ChrY:19859148..19859148
Ancestral: A
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Y9073
Forward Primer: YP1191_F AGTTCCTGTTTGGTTCTCAGC
Reverse Primer: YP1191_R GGAAATTTCAAAAGGGAGGATG
Reviews

Customers who bought this product also purchased
Y9074
Y9074
Y9079
Y9079
YP1193
YP1193
R1a-Y9073 Mortzell panel
R1a-Y9073 Mortzell panel
Y9078
Y9078
YP1190
YP1190
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies