Top » Catalog » SNPs » YP1193

$18.00

YP1193
[YP1193]

YP1193
hg38 Position: ChrY:21165652..21165652
Ancestral: G
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Y9073
Forward Primer: YP1193_F GTCACACAGGCAGGAATGC
Reverse Primer: YP1193_R CAGAAGGAAAAGCTGCAACAG
Reviews

Customers who bought this product also purchased
YP1188
YP1188
Y9075
Y9075
YP1186
YP1186
YP1194
YP1194
Y9074
Y9074
Y9079
Y9079
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies