Top » Catalog » SNPs » YP1193

$18.00

YP1193
[YP1193]

YP1193
hg38 Position: ChrY:21165652..21165652
Ancestral: G
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Y9073
Forward Primer: YP1193_F GTCACACAGGCAGGAATGC
Reverse Primer: YP1193_R CAGAAGGAAAAGCTGCAACAG
Reviews

Customers who bought this product also purchased
YP1194
YP1194
Y9074
Y9074
Y9079
Y9079
YP1191
YP1191
R1a-Y9073 Mortzell panel
R1a-Y9073 Mortzell panel
Y9078
Y9078
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies