Top » Catalog » SNPs » YP1194

$18.00

YP1194
[YP1194]

YP1194
hg38 Position: ChrY:21827376..21827376
Ancestral: C
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Y9073
Forward Primer: YP1194_F ATTTGGGTCCTCTGAAAGTAGTG
Reverse Primer: YP1194_R CTTCTTGGTCGGGTTTCACTAG
Reviews

Customers who bought this product also purchased
Y9074
Y9074
Y9079
Y9079
YP1191
YP1191
R1a-Y9073 Mortzell panel
R1a-Y9073 Mortzell panel
Y9078
Y9078
YP1190
YP1190
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies