Top » Catalog » SNPs » VK02

$18.00

VK02
[VK02]

VK02
hg38 Position: ChrY:12930674..12930674
Ancestral: A
Derived: C
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: VK02_F AGCCAAAGTCAAACCTCAATG
Reverse Primer: VK02_R GCTCCAGAATTTGTTTCCAAAG
Reviews

Customers who bought this product also purchased
VK06
VK06
VK05
VK05
VK04
VK04
VK09
VK09
R1a-VK02 Segregation Panel
R1a-VK02 Segregation Panel
VK08
VK08
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies