Top » Catalog » SNPs » VK02

$18.00

VK02
[VK02]

VK02
hg38 Position: ChrY:12930674..12930674
Ancestral: A
Derived: C
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: VK02_F AGCCAAAGTCAAACCTCAATG
Reverse Primer: VK02_R GCTCCAGAATTTGTTTCCAAAG
Reviews

Customers who bought this product also purchased
VK08
VK08
VK07
VK07
VK06
VK06
VK05
VK05
VK04
VK04
VK09
VK09
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies