Top » Catalog » SNPs » VK04

$18.00

VK04
[VK04]

VK04
hg38 Position: ChrY:15950274..15950274
Ancestral: G
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: VK04_F CTTGTAATAACATGTGTGAACAGAGTC
Reverse Primer: VK04_R CTATTGTTTCTGTTTTTAATCATCGG
Reviews

Customers who bought this product also purchased
VK08
VK08
VK07
VK07
VK06
VK06
VK03
VK03
VK02
VK02
VK09
VK09
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies