Top » Catalog » SNPs » VK04

$18.00

VK04
[VK04]

VK04
hg38 Position: ChrY:15950274..15950274
Ancestral: G
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: VK04_F CTTGTAATAACATGTGTGAACAGAGTC
Reverse Primer: VK04_R CTATTGTTTCTGTTTTTAATCATCGG
Reviews

Customers who bought this product also purchased
VK02
VK02
VK09
VK09
R1a-VK02 Segregation Panel
R1a-VK02 Segregation Panel
VK08
VK08
VK07
VK07
VK06
VK06
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies