Top » Catalog » SNPs » VK05

$18.00

VK05
[VK05]

VK05
hg38 Position: ChrY:17067899..17067899
Ancestral: C
Derived: T
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: VK05_F TGATGACTAATTGGTTGCACAAC
Reverse Primer: VK05_R AACGGTTATGAACTTGGAGTCC
Reviews

Customers who bought this product also purchased
VK07
VK07
VK06
VK06
VK03
VK03
VK02
VK02
VK09
VK09
R1a-VK02 Segregation Panel
R1a-VK02 Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies