Top » Catalog » SNPs » VK06

$18.00

VK06
[VK06]

VK06
hg38 Position: ChrY:2969548..2969548
Ancestral: T
Derived: G
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: VK06_F TTTCCTGATGGGAGTGTTCC
Reverse Primer: VK06_R AATACTTGGCTGGCAAAACC
Reviews

Customers who bought this product also purchased
VK04
VK04
VK03
VK03
VK02
VK02
R1a-VK02 Segregation Panel
R1a-VK02 Segregation Panel
VK05
VK05
VK08
VK08
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
2 x A18999
2 x B33
3 x A15392
3 x A19016
3 x BY126888
2 x S15560
2 x BY38200
$306.00
Haplogroup Info
Other products
Currencies