Top » Catalog » SNPs » VK07

$18.00

VK07
[VK07]

VK07
hg38 Position: ChrY:7855140..7855140
Ancestral: T
Derived: C
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: VK07_F GTAGTTGACAAACATTGATGAGGG
Reverse Primer: VK07_R CTACCATGGAATATAGAAATTAGCCTATG
Reviews

Customers who bought this product also purchased
VK03
VK03
VK02
VK02
R1a-VK02 Segregation Panel
R1a-VK02 Segregation Panel
VK05
VK05
VK04
VK04
VK09
VK09
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z44622
1 x A1669
1 x Z39695
1 x A4577
1 x A1583
$90.00
Haplogroup Info
Other products
Currencies