Top » Catalog » SNPs » VK08

$18.00

VK08
[VK08]

VK08
hg38 Position: ChrY:8192928..8192928
Ancestral: T
Derived: C
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: VK08_F TATACTATGTGTACATGGACGTATGTATAACG
Reverse Primer: VK08_R AACTGAATGAATGTATATCCAATTTGTC
Reviews

Customers who bought this product also purchased
VK02
VK02
R1a-VK02 Segregation Panel
R1a-VK02 Segregation Panel
VK05
VK05
VK04
VK04
VK03
VK03
VK09
VK09
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies