Top » Catalog » SNPs » VK09

$18.00

VK09
[VK09]

VK09
hg38 Position: ChrY:17058662..17058662
Ancestral: T
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: VK09_F CCTTCCTCTTAACCCCTTCG
Reverse Primer: VK09_R ACAGAAGAAGCAGCGTGGAG
Reviews

Customers who bought this product also purchased
R1a-VK02 Segregation Panel
R1a-VK02 Segregation Panel
VK05
VK05
VK04
VK04
VK03
VK03
VK02
VK02
VK08
VK08
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies