Top » Catalog » SNPs » S9767

$18.00

S9767
[S9767]

S9767
hg38 Position: ChrY:7178752..7178752
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream L1335 > L1065 > S744 > S764
Forward Primer: S9767_F ACCCACCAGAACAAGGATTC
Reverse Primer: S9767_R CCCTTGGAGTCCTGACAAAG
Reviews

Customers who bought this product also purchased
S756
S756
BY3144
BY3144
BY150
BY150
Z17614
Z17614
FGC32994
FGC32994
FGC28987
FGC28987
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies